Solid phase phosphotriester synthesis of large oligodeoxyribonucleotides on a polyamide support.
Phosphotriester solid phase methodology on a polyamide support [(1980) Nucleic Acids Research, 8, 1081-1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGGGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC). Thus, oligodeoxyribonucleotides comparable in size to those obtained by solution synthesis are readily accessible using solid phase techniques. An approach to the purification of the synthetic octadecanucleotide without recourse to high performance liquid chromatography is described.
10 references, click to expand
-
Letter: Polyamide supports for polypeptide synthesis.J Am Chem Soc. 1975 Oct 29;97(22):6584-5 PMID: 1184872
-
Synthesis and cloning of operator DNA of the lac operon of E. coli.Can J Biochem. 1977 Nov;55(11):1125-33 PMID: 336161
-
Rapid synthesis of oligodeoxyribonucleotides. II. Machine-aided solid-phase syntheses of two nonanucleotides and an octanucleotide.Nucleic Acids Res. 1977 Dec;4(12):4391-410 PMID: 600800
-
High-pressure liquid chromatography in polynucleotide synthesis.Biochemistry. 1978 Apr 4;17(7):1257-67 PMID: 656387
-
Protected deoxyribonucleoside-3' aryl phosphodiesters as key intermediates in polynucleotide synthesis. Construction of an icosanucleotide analogous to the sequence at the ends of Rous sarcoma virus 35S RNA.Nucleic Acids Res. 1979 Apr;6(4):1557-70 PMID: 221888
-
Rapid synthesis of oligodeoxyribonucleotides on a grafted polymer support.Nucleic Acids Res. 1979;6(6):2041-56 PMID: 461181
-
Synthesis of the human insulin gene. Part II. Further improvements in the modified phosphotriester method and the synthesis of seventeen deoxyribooligonucleotide fragments constituting human insulin chains B and mini-CDNA.Nucleic Acids Res. 1979 Dec 20;7(8):2199-212 PMID: 230464
-
Sequencing end-labeled DNA with base-specific chemical cleavages.Methods Enzymol. 1980;65(1):499-560 PMID: 6246368
-
Synthesis of oligonucleotides on cellulose by a phosphotriester method.Nucleic Acids Res. 1980 May 24;8(10):2331-48 PMID: 7433092
-
Rapid synthesis of oligodeoxyribonucleotides. IV. Improved solid phase synthesis of oligodeoxyribonucleotides through phosphotriester intermediates.Nucleic Acids Res. 1980 Mar 11;8(5):1081-96 PMID: 7443540
Contact
No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong
Qilu Normal University · Genelibs Bioinformatics Lab
750 Shunhua Rd, Jinan
2F, Bldg F, University Science Park
Tel: 0531-88819269
WeChat Official Account
Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.
Business Email
E-mail: product@genelibs.com
Copyright © 2026.Genelibs Jinan Honghui Biotechnology Co., Ltd. 鲁ICP备20007159号-2
