Abstract
A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified reverse transcriptase (RNA-directed DNA polymerase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC 2.7.7.7) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W. Gilbert, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by reverse transcriptase which involve terminally repeated nucleotide sequences are discussed.
MeSH Terms
Avian Sarcoma Viruses/analysis
Base Sequence
Poly A
RNA, Viral/analysis
RNA-Directed DNA Polymerase/metabolism
Chemicals
RNA, Viral
Poly A
RNA-Directed DNA Polymerase
Authors & Affiliations
3 authors, click to expand affiliations / ORCID
Schwartz D E
Zamecnik P C
Weith H L
References (13)
13 references, click to expand
-
The use of primed synthesis by DNA polymerase I to study an intercistronic sequence of phiX-174 DNA.
Eur J Biochem. 1975 Oct 15;58(2):383-95
PMID: 1102305
-
THE EFFECT OF UREA, FORMAMIDE, AND GLYCOLS ON THE SECONDARY BINDING FORCES IN THE ION-EXCHANGE CHROMATOGRAPHY OF POLYNUCLEOTIDES OF DEAE-CELLULOSE.
Biochemistry. 1963 Jul-Aug;2:697-702
PMID: 14075100
-
Site on the RNA of an avian sarcoma virus at which primer is bound.
J Virol. 1975 Sep;16(3):553-8
PMID: 169390
-
Covalently closed circular DNA of avian sarcoma virus: purification from nuclei of infected quail tumor cells and measurement by electron microscopy and gel electrophoresis.
J Mol Biol. 1976 Sep 15;106(2):337-57
PMID: 185393
-
The 3' terminal sequence of chicken ovalbumin messenger RNA and its comparison with other messenger RNA molecules.
J Mol Biol. 1976 Nov 15;107(4):527-47
PMID: 187753
-
Transcription of DNA from the 70S RNA of Rous sarcoma virus. II. Structure of a 4S RNA primer.
J Virol. 1974 May;13(5):1134-42
PMID: 4132920
-
The 3'-terminal nucleosides of the high molecular weight RNA of avian myeloblastosis virus.
Proc Natl Acad Sci U S A. 1972 May;69(5):1176-80
PMID: 4338584
-
Synthetic polynucleotides. Enzymic synthesis of ribonucleotide terminated oligodeoxynucleotides and their use as primers for the enzymic synthesis of polydeoxynucleotides.
Eur J Biochem. 1971 Oct 14;22(3):310-20
PMID: 5125354
-
Evidence for circularization of the avian oncornavirus RNA genome during proviral DNA synthesis from studies of reverse transcription in vitro.
Proc Natl Acad Sci U S A. 1976 Apr;73(4):1329-32
PMID: 57620
-
The DNA provirus hypothesis.
Science. 1976 Jun 11;192(4244):1075-80
PMID: 58444
-
Ordered transcription of RNA tumor virus genomes.
J Mol Biol. 1976 Sep 5;106(1):109-31
PMID: 61277
-
Rous sarcoma virus genome is terminally redundant: the 5' sequence.
Proc Natl Acad Sci U S A. 1977 Mar;74(3):989-93
PMID: 66683
-
3' non-coding region sequences in eukaryotic messenger RNA.
Nature. 1976 Sep 16;263(5574):211-4
PMID: 822353