The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).
No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong
Qilu Normal University · Genelibs Bioinformatics Lab
750 Shunhua Rd, Jinan
2F, Bldg F, University Science Park
Tel: 0531-88819269
Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.
Business Email
E-mail: product@genelibs.com