The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.
No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong
Qilu Normal University · Genelibs Bioinformatics Lab
750 Shunhua Rd, Jinan
2F, Bldg F, University Science Park
Tel: 0531-88819269
Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.
Business Email
E-mail: product@genelibs.com