Home LiteratureArticle Details
PMID: 7301591 Published · ppublish English Journal Article Research Support, Non-U.S. Gov't

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

Nucleic acids research ·Vol. 9 ·No. 20 ·1981-10-24 ·Pages 5407-10

Hori H, Sawada M, Osawa S, Murao K, Ishikura H

Abstract

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

MeSH Terms
Base Sequence Molecular Weight Mycoplasma/analysis Nucleic Acid Conformation RNA, Ribosomal
Chemicals
RNA, Ribosomal
Authors & Affiliations
5 authors, click to expand affiliations / ORCID
Hori H
Sawada M
Osawa S
Murao K
Ishikura H
References (18)
18 references, click to expand
  1. Nucleotide sequence of 5S-ribosomal RNA from Escherichia coli.
    Nature. 1967 Aug 12;215(5102):735-6 PMID: 4862513
  2. Isolation and analysis of the deoxyribonucleic acid of Mycoplasma mycoides var. Capri.
    Nature. 1963 May 11;198:588-9 PMID: 13964684
  3. Genome size and evolution.
    Chromosoma. 1973;40(2):121-6 PMID: 4565043
  4. Cell biology of the mycoplasmas.
    Bacteriol Rev. 1972 Sep;36(3):263-90 PMID: 4345848
  5. Physiology of mycoplasmas.
    Adv Microb Physiol. 1973;10:1-80 PMID: 4594740
  6. Characterization of some caprine mycoplasmas, with proposals for new species, mycoplasma capricolum and mycoplasma putrefaciens.
    J Gen Microbiol. 1974 Nov;85(1):102-20 PMID: 4612102
  7. A fragment of 23S RNA containing a nucleotide sequence complementary to a region of 5S RNA.
    FEBS Lett. 1975 May 1;53(2):248-52 PMID: 1095416
  8. The primary structure of Bacillus subtilis and Bacillus stearothermophilus 5 S ribonucleic acids.
    J Biol Chem. 1976 May 25;251(10):3122-7 PMID: 818086
  9. The first nucleotide sequence of an organelle transfer RNA: chloroplastic tRNAphe.
    Cell. 1976 Dec;9(4 PT 2):717-23 PMID: 828079
  10. Studies on the sequence of the 3'-terminal region of turnip-yellow-mosaic-virus RNA.
    Eur J Biochem. 1977 Feb;72(3):465-78 PMID: 402264
  11. The nucleotide sequence of formylmethionine tRNA from Mycoplasma mycoides sp. capri.
    Nucleic Acids Res. 1978 Jan;5(1):57-70 PMID: 347398
  12. A different approach to RNA sequencing.
    Nature. 1978 Jul 6;274(5666):87-9 PMID: 662002
  13. Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species.
    Proc Natl Acad Sci U S A. 1979 Jan;76(1):381-5 PMID: 284354
  14. Direct chemical method for sequencing RNA.
    Proc Natl Acad Sci U S A. 1979 Apr;76(4):1760-4 PMID: 377283
  15. Nucleotide sequence of starfish initiator tRNA.
    Nucleic Acids Res. 1979 Aug 10;6(11):3459-69 PMID: 386274
  16. The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri.
    Nucleic Acids Res. 1980 Jun 25;8(12):2783-6 PMID: 7001357
  17. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
    Nucleic Acids Res. 1980 Nov 25;8(22):5423-6 PMID: 6780979
  18. Characterization of ribosomes and RNAs from Mycoplasma hominis.
    Biochim Biophys Acta. 1971 Oct 14;247(2):262-79 PMID: 4942459
Article Info
Journal
Nucleic acids research
Abbr.
Nucleic Acids Res
ISSN
0305-1048
Published
1981-10-24
Pages
5407-10
Language
English
Region
England
NLM ID
0411011
PMCID
PMC327528
Subset
IM
Databases
GENBANK
V00646
Analysis Services
Analysis Services

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: product@genelibs.com