The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.
The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology with the 55 rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 55 rRNAs are even less homologous. Examination of the potential for forming secondary structure is revealing. T. acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs. Instead this 5S rRNA has a mixture of the characteristic features of each. On the whole this 5S rRNA does however appear more eucaryotic than eubacterial. These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization.
16 references, click to expand
-
The chemical composition of the nucleic acids and other macromolecular constituents of Mycoplasma mycoides var. capri.J Gen Microbiol. 1965 Sep;40(3):405-11 PMID: 5864893
-
Phy M: an RNase activity specific for U and A residues useful in RNA sequence analysis.Nucleic Acids Res. 1980 Jul 25;8(14):3133-42 PMID: 6160466
-
Structure and function of 5S ribosomal ribonucleic acid from Torulopsis utilis. II. Partial digestion with ribonucleases and derivation of the complete sequence.J Biochem. 1974 Nov;76(5):935-47 PMID: 4476733
-
5S RNA secondary structure.Nature. 1975 Aug 7;256(5517):505-7 PMID: 808733
-
Molecular evolution of 5S RNA.Mol Gen Genet. 1976 May 7;145(2):119-23 PMID: 934049
-
Partial enzyme digestion studies on Escherichia coli, Pseudomonas, Chlorella, Drosophila, HeLa and yeast 5S RNAs support a general class of 5S RNA models.J Mol Evol. 1977 Sep 20;10(1):77-86 PMID: 409850
-
The nucleotide sequence of formylmethionine tRNA from Mycoplasma mycoides sp. capri.Nucleic Acids Res. 1978 Jan;5(1):57-70 PMID: 347398
-
Archaebacteria.J Mol Evol. 1978 Aug 2;11(3):245-51 PMID: 691075
-
3'-terminal labelling of RNA with T4 RNA ligase.Nature. 1978 Oct 12;275(5680):560-1 PMID: 692735
-
Use of in vitro 32P labeling in the sequence analysis of nonradioactive tRNAs.Methods Enzymol. 1979;59:58-109 PMID: 220499
-
RNA sequence determination in the nanogram range by a combination of in vitro labeling procedures.Anal Biochem. 1979 Mar;93(2):321-8 PMID: 464264
-
Rapid RNA sequencing: nucleases from Staphylococcus aureus and Neurospora crassa discriminate between uridine and cytidine.Nucleic Acids Res. 1979 Aug 10;6(11):3481-90 PMID: 158747
-
Phylogenetic analysis of the mycoplasmas.Proc Natl Acad Sci U S A. 1980 Jan;77(1):494-8 PMID: 6928642
-
Evolutionary relationship between Halobacterium cutirubrum and eukaryotes determined by use of aminoacyl-tRNA synthetases as phylogenetic probes.Can J Biochem. 1980 Mar;58(3):213-8 PMID: 6989454
-
The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri.Nucleic Acids Res. 1980 Jun 25;8(12):2783-6 PMID: 7001357
-
The use of ribonuclease U2 in RNA sequence determination. Some corrections in the catalog of oligomers produced by ribonuclease T1 digestion of Escherichia coli 16S ribosomal RNA.J Mol Evol. 1974 Feb 28;3(1):63-77 PMID: 4597768
Contact
No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong
Qilu Normal University · Genelibs Bioinformatics Lab
750 Shunhua Rd, Jinan
2F, Bldg F, University Science Park
Tel: 0531-88819269
WeChat Official Account
Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.
Business Email
E-mail: product@genelibs.com
Copyright © 2026.Genelibs Jinan Honghui Biotechnology Co., Ltd. 鲁ICP备20007159号-2
