Home LiteratureArticle Details
PMID: 7031603 Published · ppublish English Journal Article Research Support, U.S. Gov't, P.H.S.

Yeast deRNA viral transcriptase pause products: identification of the transcript strand.

Nucleic acids research ·Vol. 9 ·No. 19 ·1981-10-10 ·Pages 5049-59

Brennan VE, Bobek LA, Bruenn JA

Abstract

ScV-L is a double-stranded RNA virus of the yeast Saccharomyces cerevisiae. The virus possesses a capsid-associated transcriptase activity the product of which is a single-stranded RNA complementary to only one strand of the double-stranded RNA template (L). We show that the U-rich 3' terminus of L is the initiation site of transcription and that a number of pause products are made. One prominent product has the sequence pppGAAAAAUUUUUAAAUUCAUAUAACUOH.

MeSH Terms
DNA-Directed RNA Polymerases/metabolism RNA, Double-Stranded/metabolism RNA, Viral/metabolism Saccharomyces cerevisiae/genetics Transcription, Genetic
Chemicals
RNA, Double-Stranded RNA, Viral DNA-Directed RNA Polymerases
Authors & Affiliations
3 authors, click to expand affiliations / ORCID
Brennan V E
Bobek L A
Bruenn J A
References (26)
26 references, click to expand
  1. Virion DNA-independent RNA polymerase from Saccharomyces cerevisiae.
    Nucleic Acids Res. 1980 Jun 11;8(11):2349-63 PMID: 7003533
  2. Yeast killer toxin: purification and characterisation of the protein toxin from Saccharomyces cerevisiae.
    Eur J Biochem. 1979 Feb 1;93(3):487-93 PMID: 33806
  3. Isolation of Suppressive Sensitive Mutants from Killer and Neutral Strains of SACCHAROMYCES CEREVISIAE.
    Genetics. 1973 Aug;74(4):571-9 PMID: 17248628
  4. Nucleotide sequence of the putative recognition site for coat protein in the RNAs of alfalfa mosaic virus and tobacco streak virus.
    Nucleic Acids Res. 1980 Aug 11;8(15):3307-18 PMID: 6160470
  5. Plasmids controlled exclusion of the K2 killer double-stranded RNA plasmid of yeast.
    Cell. 1980 Aug;21(1):217-26 PMID: 6996833
  6. Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose.
    Proc Natl Acad Sci U S A. 1980 Sep;77(9):5201-5 PMID: 6159641
  7. Translational analysis of the killer-associated virus-like particle dsRNA genome of S. cerevisiae: M dsRNA encodes toxin.
    Cell. 1980 Feb;19(2):403-14 PMID: 6986991
  8. Nucleotide sequences at the 5'-termini of the alfalfa mosaic virus RNAs and the intercistronic junction in RNA 3.
    Nucleic Acids Res. 1980 Dec 11;8(23):5635-47 PMID: 6927843
  9. Preparative two-dimensional polyacrylamide gel electrophoresis of 32 P-labeled RNA.
    Anal Biochem. 1972 Sep;49(1):184-97 PMID: 5081097
  10. Electron microscopic heteroduplex analysis of "killer" double-stranded RNA species from yeast.
    Proc Natl Acad Sci U S A. 1978 Sep;75(9):4224-8 PMID: 360211
  11. Yeast virus-like particles possess a capsid-associated single-stranded RNA polymerase.
    Nature. 1977 Aug 4;268(5619):464-6 PMID: 895855
  12. Relatedness of the double-stranded RNAs present in yeast virus-like particles.
    J Virol. 1978 Jun;26(3):762-72 PMID: 353302
  13. Biochemical and physiological studies of the yeast virus-like particle.
    J Bacteriol. 1977 Jun;130(3):1303-9 PMID: 324982
  14. Nucleotide sequence of 5' terminus of alfalfa mosaic virus RNA 4 leading into coat protein cistron.
    Proc Natl Acad Sci U S A. 1977 Dec;74(12):5504-8 PMID: 271973
  15. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridization with DNA probes.
    Proc Natl Acad Sci U S A. 1977 Dec;74(12):5350-4 PMID: 414220
  16. Virus-like particles associated with the double-stranded RNA species found in killer and sensitive strains of the yeast Saccharomyces cerevisiae.
    J Gen Virol. 1974 Mar;22(3):387-94 PMID: 4594342
  17. No homology between double-stranded RNA and nuclear DNA of yeast.
    J Virol. 1978 Dec;28(3):1002-5 PMID: 366175
  18. Yeast viral RNA polymerase is a transcriptase.
    Nucleic Acids Res. 1980 Jul 11;8(13):2985-97 PMID: 7001359
  19. Evolution of defective-interfering double-stranded RNAs of the yeast killer virus.
    J Virol. 1979 Nov;32(2):692-6 PMID: 387980
  20. Direct chemical method for sequencing RNA.
    Proc Natl Acad Sci U S A. 1979 Apr;76(4):1760-4 PMID: 377283
  21. Translation of the L-species dsRNA genome of the killer-associated virus-like particles of Saccharomyces cerevisiae.
    J Biol Chem. 1977 Dec 25;252(24):9010-7 PMID: 336627
  22. Transcription of killer virion double-stranded RNA in vitro.
    Nucleic Acids Res. 1980 Jun 11;8(11):2365-75 PMID: 7003534
  23. The 5' ends of yeast killer factor RNAs are pppGp.
    Nucleic Acids Res. 1976 Oct;3(10):2427-36 PMID: 792814
  24. Yeast viral double-stranded RNAs have heterogeneous 3' termini.
    Cell. 1980 Apr;19(4):923-33 PMID: 6991125
  25. Twenty-six chromosomal genes needed to maintain the killer double-stranded RNA plasmid of Saccharomyces cerevisiae.
    Genetics. 1978 Mar;88(3):419-25 PMID: 346439
  26. Virus-like particles and double stranded RNA from killer and non-killer strains of Saccharomyces cerevisiae.
    Microbios. 1978;21(85-86):161-76 PMID: 377028
Article Info
Journal
Nucleic acids research
Abbr.
Nucleic Acids Res
ISSN
0305-1048
DOI
10.1093/nar/9.19.5049
Published
1981-10-10
Pages
5049-59
Language
English
Region
England
NLM ID
0411011
PMCID
PMC327498
Subset
IM
Grants
NIGMS NIH HHS · GM22200 · United States
External Links
PubMed source DOI: 10.1093/nar/9.19.5049 PMC Full Text View journal details
Analysis Services
Analysis Services

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: product@genelibs.com

Copyright © 2026.Genelibs Jinan Honghui Biotechnology Co., Ltd. 鲁ICP备20007159号-2