Abstract
Nucleoside 3'-phosphoramidite and chlorophosphite reagents have been found to react with the lactam function of guanine. This reaction caused unsatisfactory results when oligodeoxyribonucleotides containing a large number of guanine bases were prepared in an automated solid phase synthesizer. The guanine modification is unstable, and leads to depurination and chain cleavage. This side reaction can be eliminated by protecting the O6-position. A new O6-p-nitrophenylethyldeoxyguanosine phosphoramidite derivative, 8, was used to prepare sequences containing up to 24 guanine bases with greatly improved results. A hexatriacontanucleotide, d(CGCGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCTCA), was also prepared using O6-protected deoxyguanosine nucleosides.
MeSH Terms
Chromatography, Thin Layer
DNA/chemical synthesis
DNA Replication
Electrophoresis, Polyacrylamide Gel
Guanine
Indicators and Reagents
Magnetic Resonance Spectroscopy
Oligodeoxyribonucleotides/chemical synthesis
Organophosphorus Compounds
Structure-Activity Relationship
Chemicals
Indicators and Reagents
Oligodeoxyribonucleotides
Organophosphorus Compounds
Guanine
DNA
Authors & Affiliations
3 authors, click to expand affiliations / ORCID
Pon R T
Damha M J
Ogilvie K K
References (9)
9 references, click to expand
-
DNA chain length markers and the influence of base composition on electrophoretic mobility of oligodeoxyribonucleotides in polyacrylamide-gels.
Nucleic Acids Res. 1979;6(6):2069-87
PMID: 461182
-
Synthesis of oligodeoxyribonucleotides on silica gel support.
Nucleic Acids Res. 1981 Jun 25;9(12):2807-17
PMID: 6269061
-
Automated synthesis of gene fragments.
Science. 1981 Oct 16;214(4518):270-4
PMID: 6169150
-
Studies on transfer ribonucleic acids and related compounds. XLV. Block condensation of ribooligonucleotides containing 2'-O-tetrahydrofuranyl-5'-O-dimethoxytritylnucleosides.
Nucleic Acids Res. 1983 Mar 11;11(5):1325-35
PMID: 6828384
-
Solid-phase synthesis of the self-complementary hexamer d(c7GpCpc7GpCpc7GpC) via the O-3'-phosphoramidite of 7-deaza-2'-deoxyguanosine.
Nucleic Acids Res. 1985 Feb 11;13(3):911-26
PMID: 4000931
-
A rapid deprotection procedure for phosphotriester DNA synthesis.
Nucleic Acids Res. 1984 Sep 11;12(17):6853-9
PMID: 6483622
-
Construction and evaluation of an instrument for the automated synthesis of oligodeoxyribonucleotides.
DNA. 1984 Oct;3(5):401-11
PMID: 6510189
-
Methylation of thymine residues during oligonucleotide synthesis.
Nucleic Acids Res. 1985 Jan 25;13(2):573-84
PMID: 4000926
-
Synthesis and use of synthetic oligonucleotides.
Annu Rev Biochem. 1984;53:323-56
PMID: 6383196