Home LiteratureArticle Details
PMID: 2985828 Published · ppublish English Journal Article Research Support, U.S. Gov't, P.H.S.

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

Journal of virology ·Vol. 54 ·No. 2 ·1985-05-00 ·Pages 639-42

Casey TA, Ruyechan WT, Flora MN, Reinhold W, Straus SE, Hay J

Abstract

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.

MeSH Terms
DNA, Viral/analysis Herpesvirus 3, Human/genetics Repetitive Sequences, Nucleic Acid Species Specificity
Chemicals
DNA, Viral
Authors & Affiliations
6 authors, click to expand affiliations / ORCID
Casey T A
Ruyechan W T
Flora M N
Reinhold W
Straus S E
Hay J
References (19)
19 references, click to expand
  1. A new method for sequencing DNA.
    Proc Natl Acad Sci U S A. 1977 Feb;74(2):560-4 PMID: 265521
  2. DNA of Epstein-Barr virus. III. Identification of restriction enzyme fragments that contain DNA sequences which differ among strains of Epstein-Barr virus.
    J Virol. 1978 Aug;27(2):388-98 PMID: 211267
  3. Restriction endonuclease fingerprinting of herpes simplex virus DNA: a novel epidemiological tool applied to a nosocomial outbreak.
    J Infect Dis. 1978 Oct;138(4):488-98 PMID: 213496
  4. The polypeptide and the DNA restriction enzyme profiles of spontaneous isolates of herpes simplex virus type 1 from explants of human trigeminal, superior cervical and vagus ganglia.
    J Gen Virol. 1979 Apr;43(1):151-71 PMID: 225415
  5. BamI, KpnI, and SalI restriction enzyme maps of the DNAs of herpes simplex virus strains Justin and F: occurrence of heterogeneities in defined regions of the viral DNA.
    J Virol. 1979 Nov;32(2):429-41 PMID: 228068
  6. Extraction of nucleic acids from agarose gels.
    Anal Biochem. 1980 Apr;103(2):264-71 PMID: 6155806
  7. XbaI, PstI, and BglII restriction enzyme maps of the two orientations of the varicella-zoster virus genome.
    J Virol. 1981 Aug;39(2):390-400 PMID: 6268830
  8. Nucleotide sequences of the joint between the L and S segments of herpes simplex virus types 1 and 2.
    J Gen Virol. 1981 Aug;55(Pt 2):315-31 PMID: 6270266
  9. Restriction endonuclease analysis of the DNA from varicella-zoster virus: stability of the DNA after passage in vitro.
    J Gen Virol. 1981 Jul;55(Pt 1):207-11 PMID: 6271904
  10. Varicella zoster virus DNA exists as two isomers.
    Proc Natl Acad Sci U S A. 1982 Jan;79(1):156-60 PMID: 6275385
  11. Molecular cloning and physical mapping of varicella-zoster virus DNA.
    Proc Natl Acad Sci U S A. 1982 Feb;79(4):993-7 PMID: 6280178
  12. Herpesvirus saimiri strain variability.
    J Virol. 1982 Jul;43(1):352-6 PMID: 6287011
  13. DNA sequence analysis of an immediate-early gene region of the herpes simplex virus type 1 genome (map coordinates 0.950 to 0.978).
    J Gen Virol. 1982 Sep;62 (Pt 1):1-15 PMID: 6290591
  14. Structure and role of the herpes simplex virus DNA termini in inversion, circularization and generation of virion DNA.
    Cell. 1982 Nov;31(1):89-97 PMID: 6297756
  15. Alterations in the equine herpesvirus 1 genome after in vitro and in vivo virus passage.
    Infect Immun. 1983 Apr;40(1):436-9 PMID: 6299965
  16. Genome differences among varicella-zoster virus isolates.
    J Gen Virol. 1983 May;64(Pt 5):1031-41 PMID: 6302208
  17. Equalization of the inverted repeat sequences of the pseudorabies virus genome by intermolecular recombination.
    Virology. 1984 Jan 30;132(2):303-14 PMID: 6322414
  18. Endonuclease analysis of viral DNA from varicella and subsequent zoster infections in the same patient.
    N Engl J Med. 1984 Nov 22;311(21):1362-4 PMID: 6092956
  19. Distribution of G + C-rich regions in varicella-zoster virus DNA.
    J Gen Virol. 1985 Jan;66 ( Pt 1):43-54 PMID: 2981960
Article Info
Journal
Journal of virology
Abbr.
J Virol
ISSN
0022-538X
DOI
10.1128/JVI.54.2.639-642.1985
Published
1985-05-00
Pages
639-42
Language
English
Region
United States
NLM ID
0113724
PMCID
PMC254841
Subset
IM
Grants
NIAID NIH HHS · AI18449 · United States
External Links
PubMed source DOI: 10.1128/JVI.54.2.639-642.1985 PMC Full Text View journal details
Analysis Services
Analysis Services

Contact

No. 2 Wenbo Road, Zhangqiu District, Jinan, Shandong

Qilu Normal University · Genelibs Bioinformatics Lab

750 Shunhua Rd, Jinan

2F, Bldg F, University Science Park

Tel: 0531-88819269

WeChat Official Account

Follow our WeChat subscription account for real-time updates and the latest in medical and biological research.


Business Email

E-mail: product@genelibs.com

Copyright © 2026.Genelibs Jinan Honghui Biotechnology Co., Ltd. 鲁ICP备20007159号-2